FunGal Boob Replacement Therapy

After Doc Shoals’ breastisis blog went out of business (1), Nurse Moneypenny organically sculpted the mammary glands of Eileen Dover Dumplings using FunGal Boob Replacement Therapy…

Loading FunGal Boobs
Photo Credit: Disclaimer
Eileen Dover Dumplings believes her FunGal breastisis implants provide more bounce than the traditional silly-cone implants.

The Breastisis mutation of Eileen Dover’s magic mushboobs occurred in Nurse Moneypenny’s Shamanic Twin FunGal Medical Labs when Eileen Dover’s Boobs were homogeneously hybridized using a FunGal hybrid of Psychedelic Mushroom Breasts, a hallucinogenic species of Psilocybe, heterozygously spliced into Eileen Dover’s DNA sequence ATATTTCCACCTGTGCACTTTT …

Loading Magic Mushboobs

Magic Mushrooms similar to Psilocybe cubensis Mazatapec or
Psilocybe cubensis Equador

“Show Them To Me” by Rodney Carrington

Lyrics

Oh it seems to me this whole world’s gone crazy
There’s too much hate and killin goin on
But when I see the bare chest of a woman
My worrys and my problems are all gone
No one thinks of fightin, when they see a topless girl
Baby if you would show yours too, we could save the world

Show them to me, show them to me
Unclasp your bra and set those puppies free
They’d look a whole lot better without that sweater baby I’m sure you’ll agree
If you got, two fun bags,
Show them to me

I don’t care if they don’t match or ones bigger than the other
You could show me one, and I’ll imagine the other
Even if you’re really old, theres nothing wrong
Don’t be sad your boobs ain’t bad, they’re just a little long

Show them to me, show them to me
Lift up your shirt and let the whole world see
Just disrobe, show your globes and a happy man I’ll be
If you got, dos chichi’s,
Show them to me

I’ve met a lot of them, but never one I’ve hated
Even if you’ve had thirteen kids and you think they look deflated
Theres no such thing as a bad breast, I believe this much is true
If you’re a big fat man I’m a titty fan and I’d love to see yours toooo

Show them to me, show them to me
Just like the girls gone wild on T.V.
Just lean back and show your rack and I’ll be in ecstasy
If you got two casabas
Show them to me

All the world will live in harmony
It’ll do you good, it’ll give me wood, we’ll make history
If you love your country, I’m gonna say it one more time,
I said if you love your country yea
Then stand your ass up and show them big old titties to me

twitter


Miss Moneypenny

@ tinyurl.com/cklkbqz Buoyancy (.) (.) Boobs will save all Hands on Deck. :~)

Mike

@ LOL! Is she exempt from wearing flotation devices on boats? ;)

*For your reading and laughing pleasure, you may also like these related posts…

Footnotes:

(1) Apparently, Doc Shoals got the shaft not the stimulus package he hoped for. As a result, Miss Moneypenny wrote this new post because Doc Shoals’ breastisis post was sucked into the Black Hole of Google’s Pork Ration Nebula with a Blogspot.

This is the second post in a series that explores Where Have all the Bloggers Gone?

(2) Photo Disclaimer: Unfortunately, we have no clue about the artist who created the Photoshop image. If anyone knows the artist than please post his/her link in the comments.

Share this post with others…

Add to FacebookAdd to NewsvineAdd to DiggAdd to Del.icio.usAdd to StumbleuponAdd to RedditAdd to BlinklistAdd to Ma.gnoliaAdd to TechnoratiAdd to Furl
[Post to Twitter] Tweet This Post
.

Miss Moneypenny reporting for the Undercover Times

Posted on November 7, 2011, in Humor, Music Monday, Titillating Tuesday and tagged , , , , , , , , , , . Bookmark the permalink. Leave a Comment.

Leave a Reply

Fill in your details below or click an icon to log in:

WordPress.com Logo

You are commenting using your WordPress.com account. Log Out / Change )

Twitter picture

You are commenting using your Twitter account. Log Out / Change )

Facebook photo

You are commenting using your Facebook account. Log Out / Change )

Connecting to %s

Follow

Get every new post delivered to your Inbox.