FunGal Boob Replacement Therapy
The Breastisis mutation of Eileen Dover’s magic mushboobs occurred in Nurse Moneypenny’s Shamanic Twin FunGal Medical Labs when Eileen Dover’s Boobs were homogeneously hybridized using a FunGal hybrid of Psychedelic Mushroom Breasts, a hallucinogenic species of Psilocybe, heterozygously spliced into Eileen Dover’s DNA sequence ATATTTCCACCTGTGCACTTTT …
Magic Mushrooms similar to Psilocybe cubensis Mazatapec or
Psilocybe cubensis Equador
“Show Them To Me” by Rodney Carrington
Lyrics
There’s too much hate and killin goin on
But when I see the bare chest of a woman
My worrys and my problems are all gone
No one thinks of fightin, when they see a topless girl
Baby if you would show yours too, we could save the world
Show them to me, show them to me
Unclasp your bra and set those puppies free
They’d look a whole lot better without that sweater baby I’m sure you’ll agree
If you got, two fun bags,
Show them to me
I don’t care if they don’t match or ones bigger than the other
You could show me one, and I’ll imagine the other
Even if you’re really old, theres nothing wrong
Don’t be sad your boobs ain’t bad, they’re just a little long
Show them to me, show them to me
Lift up your shirt and let the whole world see
Just disrobe, show your globes and a happy man I’ll be
If you got, dos chichi’s,
Show them to me
I’ve met a lot of them, but never one I’ve hated
Even if you’ve had thirteen kids and you think they look deflated
Theres no such thing as a bad breast, I believe this much is true
If you’re a big fat man I’m a titty fan and I’d love to see yours toooo
Show them to me, show them to me
Just like the girls gone wild on T.V.
Just lean back and show your rack and I’ll be in ecstasy
If you got two casabas
Show them to me
All the world will live in harmony
It’ll do you good, it’ll give me wood, we’ll make history
If you love your country, I’m gonna say it one more time,
I said if you love your country yea
Then stand your ass up and show them big old titties to me
@moneypenny008
Miss Moneypenny
@proUSAproGodMike
For your reading and laughing pleasure, you may also like these related posts…
Footnotes:
(1) Apparently, Doc Shoals got the shaft not the stimulus package he hoped for. As a result, Miss Moneypenny wrote this new post because Doc Shoals’ breastisis post was sucked into the Black Hole of Google’s Pork Ration Nebula with a Blogspot.
This is the second post in a series that explores Where Have all the Bloggers Gone?
(2) Photo Disclaimer: Unfortunately, we have no clue about the artist who created the Photoshop image. If anyone knows the artist than please post his/her link in the comments.
![[Post to Twitter]](http://moneypennydd.files.wordpress.com/2009/03/tt-big4.png?w=604 "Post to Twitter Icon")
Miss Moneypenny reporting for the Undercover Times
Posted on November 7, 2011, in Humor, Music Monday, Titillating Tuesday and tagged (.) (.), Big Boobs, Buoyancy Boobs, FunGal Boob Replacement Therapy, FunGal Boobs, Humor, Magic Mushboobs, Magic Mushrooms, Music Monday, Titillating Tuesday, Where Have all the Bloggers Gone?. Bookmark the permalink. Leave a Comment.
Leave a Comment
Comments (0)